ports/128271: biology/ncbi-toolkit - blastall segfaults when output is set to XML (-m 7)
Julien Cigar
jcigar at ulb.ac.be
Fri Oct 24 14:00:11 UTC 2008
The following reply was made to PR ports/128271; it has been noted by GNATS.
From: Julien Cigar <jcigar at ulb.ac.be>
To: Fernan Aguero <fernan at iib.unsam.edu.ar>
Cc: bug-followup at freebsd.org
Subject: Re: ports/128271: biology/ncbi-toolkit - blastall segfaults when
output is set to XML (-m 7)
Date: Fri, 24 Oct 2008 15:29:38 +0200
Hi Fernan,
Thanks for your quick answer.
I tried the three ways, but neither of them works here :
jcigar at bccm-it blast % cat ~/seq.txt
CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC%
jcigar at bccm-it blast % blastall -i ~/seq.txt -d rodentia.fasta -p blastn
-m 7
zsh: segmentation fault blastall -i ~/seq.txt -d rodentia.fasta -p
blastn -m 7
jcigar at bccm-it blast % echo "CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC"
| blastall -d rodentia.fasta -p blastn -m 7
zsh: done echo
"CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC" |
zsh: segmentation fault blastall -d rodentia.fasta -p blastn -m 7
jcigar at bccm-it blast % cat ~/foo.txt | blastall -d rodentia.fasta -p
blastn -m 7
zsh: done cat ~/foo.txt |
zsh: segmentation fault blastall -d rodentia.fasta -p blastn -m 7
I confirm too that it works perfectly with the latest version of the
ncbi tools.
Thanks
Regards,
Julien
On Fri, 2008-10-24 at 10:04 -0200, Fernan Aguero wrote:
> Julie,
>
> I can confirm this bug with blastall 2.2.14 (see attached typescript).
> I have just updated the ncbi-toolkit port to the latest version (blast
> 2.2.18) in my box and I can no longer reproduce it, so I understand
> the bug seems has been fixed.
>
> I will try to submit the update as soon as possible, but it may take
> some days, as I'm flooded with work right now.
>
> In the meantime, please notice that the segfault when requesting XML
> format does not occur in all cases (i.e. if XML is what you need you
> probably don't need to wait for the updated port).
>
> fetch ftp://ftp.ncbi.nih.gov/blast/db/FASTA/vector.gz
> gzip -d vector.gz
> formatdb -i vector.gz -p F
> echo "CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC" > test.fna
>
> Three ways of doing the same thing:
> i) blastall -p blastn -d vector -i test.fna -m7
> vs
> ii) echo "CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC" | blastall -p
> blastn -d vector -m7
> vs
> iii) cat test.fna | blastall -p blastn -d vector -m7
>
> In my hands (see attached typescript) I can only reproduce the bug
> when calling blastall as in (ii). I have never been able to get a core
> dump when calling blastall as in (i) or (iii).
>
> Cheers,
>
--
Julien Cigar
Belgian Biodiversity Platform
http://www.biodiversity.be
Université Libre de Bruxelles (ULB)
Campus de la Plaine CP 257
Bâtiment NO, Bureau 4 N4 115C (Niveau 4)
Boulevard du Triomphe, entrée ULB 2
B-1050 Bruxelles
Mail: jcigar at ulb.ac.be
@biobel: http://biobel.biodiversity.be/person/show/471
Tel : 02 650 57 52
More information about the freebsd-ports-bugs
mailing list