ports/128271: biology/ncbi-toolkit - blastall segfaults when output is set to XML (-m 7)

[Fernan Aguero]

The following reply was made to PR ports/128271; it has been noted by GNATS.

From: "Fernan Aguero" <fernan at iib.unsam.edu.ar>
To: bug-followup at freebsd.org, jcigar at ulb.ac.be
Cc:  
Subject: Re: ports/128271: biology/ncbi-toolkit - blastall segfaults when output is set to XML (-m 7)
Date: Fri, 24 Oct 2008 10:04:22 -0200

 Julie,
 
 I can confirm this bug with blastall 2.2.14 (see attached typescript).
 I have just updated the ncbi-toolkit port to the latest version (blast
 2.2.18) in my box and I can no longer reproduce it, so I understand
 the bug seems has been fixed.
 
 I will try to submit the update as soon as possible, but it may take
 some days, as I'm flooded with work right now.
 
 In the meantime, please notice that the segfault when requesting XML
 format does not occur in all cases (i.e. if XML is what you need you
 probably don't need to wait for the updated port).
 
 fetch ftp://ftp.ncbi.nih.gov/blast/db/FASTA/vector.gz
 gzip -d vector.gz
 formatdb -i vector.gz -p F
 echo "CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC" > test.fna
 
 Three ways of doing the same thing:
 i) blastall -p blastn -d vector -i test.fna -m7
 vs
 ii) echo "CGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC" | blastall -p
 blastn -d vector -m7
 vs
 iii) cat test.fna | blastall -p blastn -d vector -m7
 
 In my hands (see attached typescript) I can only reproduce the bug
 when calling blastall as in (ii). I have never been able to get a core
 dump when calling blastall as in (i) or (iii).
 
 Cheers,
 
 -- 
 fernan